kallisto

Pseudobam

The output of kallisto quant when run with the --pseudobam option is a SAM formatted stream. This stream can be redirected to a SAM file or directly to a BAM file by piping into samtools view -Sb - > output.bam. Examples of how to do this are shown in the Manual.

The SAM/BAM format is described in http://samtools.github.io/hts-specs/SAMv1.pdf

kallisto will output a SAM file showing the pseudoalignments of the reads to the transcriptome. Each read will have one SAM entry for each transcript is pseudoaligns to.

For paired end reads the output will first include all entries for the first read, followed by all entries for the second read.

Each SAM line, where a read pseudoaligns to a transcript, follows the normal SAM format with the following interpretation of the fields

  • QNAME, read name, any /1 or /2 is discarded from read names and the information is stored in the FLAG field
  • FLAG, normal SAM flags
  • RNAME, the transcript name
  • POS, 1-based position of the leftmost mapping
  • MAPQ, 255 for pseudoaligned reads, 0 otherwise
  • CIGAR, all matches (probably a lie), e.g. for 75bp reads 75M
  • RNEXT, the transcript of the mate, always equal to RNAME
  • PNEXT, the leftmost 1-based position of the mate
  • TLEN, observed template length
  • SEQ, read sequence or the reverse complement if it pseudoaligns to the reverse complement of the transcript
  • QUAL, the quality values of the read
  • optional fields
    • NH, set to the size of the equivalence class, i.e. the number of transcripts this reads pseudoaligns to.

Example output (skipping header lines)

1:NM_014620:16:182      99      NM_014620       17      255     50M     =       149     182     GTTCCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGC      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3
1:NM_014620:16:182      355     NM_153693       17      255     50M     =       149     182     GTTCCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGC      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3
1:NM_014620:16:182      355     NR_003084       17      255     50M     =       149     182     GTTCCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGC      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3
1:NM_014620:16:182      147     NM_014620       149     255     50M     =       17      -182    TAATTTTTTTTCCTCCCAGGTGGAGTTGCCGAAGCTGGGGGCAGCTGGGG      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3
1:NM_014620:16:182      403     NM_153693       149     255     50M     =       17      -182    TAATTTTTTTTCCTCCCAGGTGGAGTTGCCGAAGCTGGGGGCAGCTGGGG      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3
1:NM_014620:16:182      403     NR_003084       149     255     50M     =       17      -182    TAATTTTTTTTCCTCCCAGGTGGAGTTGCCGAAGCTGGGGGCAGCTGGGG      IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      NH:i:3

In this case the read 1:NM_014620:16:182, which was simulated from NM_014620 was aligned to 3 transcripts, one of which is NM_014620 and the mapping positions match the read name. To decode the SAM flags consult this handy guide. In cases where the read pseudoaligns to multiple transcripts, one of the alignment records is arbitrarily designated as a primary alignment and all others are secondary alignments, this is not a reflection of the quality of the alignment.