Usage¶
The seqspec
tool operates on seqspec
files and
- Facilitates the standardization of preprocessing steps across different assays,
- Enables data management and tracking,
- Simplifies the interpretation and reuse of sequencing data.
seqspec
consists of the following subcommands:
usage: seqspec [-h] <CMD> ...
seqspec 0.3.0: A machine-readable file format for genomic library sequence and structure.
GitHub: https://github.com/pachterlab/seqspec
Documentation: https://pachterlab.github.io/seqspec/
positional arguments:
<CMD>
build Generate a complete seqspec with natural language (LLM-assisted)
check Validate seqspec file against specification
find Find objects in seqspec file
file List files present in seqspec file
format Autoformat seqspec file
index Identify position of elements in seqspec file
info Get information from seqspec file
init Generate a new empty seqspec file
insert Insert regions or reads into an existing spec
methods Convert seqspec file into methods section
modify Modify attributes of various elements in seqspec file
onlist Get onlist file for elements in seqspec file
print Display the sequence and/or library structure from seqspec file
split Split seqspec file by modality
upgrade Upgrade seqspec file to current version (hidden)
version Get seqspec tool version and seqspec file version
optional arguments:
-h, --help show this help message and exit
seqspec
operates on seqspec
compatible YAML files that follow the specification. All of the following examples will use the seqspec
specification for the DOGMAseq-DIG assay which can be found here: seqspec/examples/specs/dogmaseq-dig/spec.yaml
.
seqspec check
: Validate seqspec file against specification¶
Check that the seqspec
file is correctly formatted and consistent with the specification.
seqspec check [-h] [-o OUT] [--skip {igvf,igvf_onlist_skip}] yaml
from seqspec.seqspec_check import run_check
run_check(schema_fn: str, spec_fn: str, o: str)
- optionally,
-o OUT
can be used to write the output to a file. - optionally,
--skip {igvf,igvf_onlist_skip}
can filter out known IGVF-specific warnings (see source for list). yaml
corresponds to theseqspec
file.
A list of checks performed:
- Check that the spec validates against the JSON Schema.
- Check that modalities are unique.
- Check that
region_id
s of the first level of thelibrary_spec
correspond to modalities (one per modality). - Check that onlist files exist (either as local paths or reachable URLs).
- Check that the
read_id
s in thesequence_spec
are unique. - Check that read files exist (either as local paths or reachable URLs).
- Check that read
(primer_id, strand)
pairs are unique across all reads. - Check that the
region_id
s are unique across all regions. - Check that each read
modality
exists in the assay list of modalities. - Check that each read
primer_id
exists among the region IDs in thelibrary_spec
. - Check
sequence_type
and region annotation consistencies:
- if a region has a sequence type “fixed” then it should not contain subregions
- if a region has a sequence type “joined” then it should contain subregions
- if a region has a sequence type “random” then it should not contain subregions and
sequence
should be all X’s - if a region has a sequence type “onlist” then it should have an onlist object
- Check that the
min_len
is less than or equal to themax_len
. - Check that the length of the
sequence
in every region is between themin_len
andmax_len
. - Check that the number of files in each
Read
is the same across all reads. - Check that for every region with subregions, the region
min_len
/max_len
equals the sum of the subregions’min_len
/max_len
. - Check that for every region with subregions, the region
sequence
equals the left-to-right concatenation of the subregions’sequence
s. - Check that each read’s
max_len
does not exceed the sequence-able range of library elements after (pos strand) or before (neg strand) the primer.
Below are a list of example errors one may encounter when checking a spec:
# The "assay" value was not specified in the spec
[error 1] None is not of type 'string' in spec['assay']
# The "modalities" are not using the controlled vocabulary
[error 2] 'Ribonucleic acid' is not one of ['rna', 'tag', 'protein', 'atac', 'crispr'] in spec['modalities'][0]
# The "region_type" is not using the controlled vocabulary
[error 3] 'link_1' is not one of ['atac', 'barcode', 'cdna', 'crispr', 'fastq', 'gdna', 'hic', 'illumina_p5', 'illumina_p7', 'index5', 'index7', 'linker', 'ME1', 'ME2', 'methyl', 'nextera_read1', 'nextera_read2', 'poly_A', 'poly_G', 'poly_T', 'poly_C', 'protein', 'rna', 's5', 's7', 'tag', 'truseq_read1', 'truseq_read2', 'umi'] in spec['library_spec'][0]['regions'][3]['region_type']
# The "sequence_type" is not using the controlled vocabulary
[error 4] 'linker' is not one of ['fixed', 'random', 'onlist', 'joined'] in spec['library_spec'][0]['regions'][3]['sequence_type']
# The "region_id" is not unique across the spec
[error 5] region_id 'cell_bc' is not unique across all regions
# The length of the given "sequence" is less than the "min_len" specified for the sequence
[error 6] 'sample_bc' sequence 'NNNNNNNN' length '8' is less than min_len '10'
# The "filename" for the specified "onlist" does not exist in the same location as the spec.
[error 7] i5_index_onlist.txt does not exist
# The provided "sequence" contains invalid characters (only A, C, G, T, N, and X are permitted)
[error 8] 'NNNNNNNNZN' does not match '^[ACGTNX]+$' in spec['library_spec'][0]['regions'][4]['sequence']
# The "md5" for the given "onlist" file is not a valid md5sum
[error 9] '7asddd7asd7' does not match '^[a-f0-9]{32}$' in spec['library_spec'][0]['regions'][8]['onlist']['md5']
Examples¶
# check the spec against the formal specification
$ seqspec check spec.yaml
[error 1] None is not of type 'string' in spec['assay']
[error 2] 'Ribonucleic acid' is not one of ['rna', 'tag', 'protein', 'atac', 'crispr'] in spec['modalities'][0]
seqspec find
: Find objects in seqspec file¶
seqspec find [-h] [-o OUT] [-s SELECTOR] -m MODALITY [-i ID] yaml
from seqspec.seqspec_find import run_find
run_find(spec_fn: str, modality: str, id: str, idtype: str, o: str)
- optionally,
-o OUT
can be used to write the output to a file. - optionally,
-s Selector
is the type of the ID you are searching for (default: region). Can be one of- read
- region
- file
- region-type
-m MODALITY
is the modality in which you are searching within.-i ID
the ID you are searching for.yaml
corresponds to theseqspec
file.
Examples¶
# Find reads by id
$ seqspec find -m rna -s read -i rna_R1 spec.yaml
- !Read
read_id: rna_R1
name: rna Read 1
modality: rna
primer_id: rna_truseq_read1
min_len: 28
max_len: 28
strand: pos
files:
- !File
file_id: rna_R1_SRR18677638.fastq.gz
filename: rna_R1_SRR18677638.fastq.gz
filetype: fastq
filesize: 18499436
url: fastqs/rna_R1_SRR18677638.fastq.gz
urltype: local
md5: 7eb15a70da9b729b5a87e30b6596b641
# Find regions with `barcode` region type
$ seqspec find -m rna -s region-type -i barcode spec.yaml
- !Region
region_id: rna_cell_bc
region_type: barcode
name: Cell Barcode
sequence_type: onlist
sequence: NNNNNNNNNNNNNNNN
min_len: 16
max_len: 16
onlist: !Onlist
location: local
filename: RNA-737K-arc-v1.txt
filetype: txt
filesize: 0
url: RNA-737K-arc-v1.txt
urltype: local
md5: a88cd21e801ae6f9a7d9a48b67ccf693
file_id: RNA-737K-arc-v1.txt
regions: null
parent_id: rna
seqspec file
: List files present in seqspec file¶
seqspec file [-h] [-o OUT] [-i IDs] -m MODALITY [-s SELECTOR] [-f FORMAT] [-k KEY] [--fullpath] yaml
from seqspec.seqspec_file import run_file
run_file(spec_fn: str, m: str, ids: List[str], idtype: str, fmt: str, k: str, o: str, fp=False)
- optionally,
-o OUT
can be used to write the output to a file. - optionally,
-s Selector
is the type of the ID you are searching for (default: read). Can be one of- read
- region
- file
- region-type
- optionally,
-f FORMAT
is the format to return the list of files. Can be one of- paired
- interleaved
- index
- list
- json
- optionally,
-k KEY
is the key to display for the file (default: file_id). Can be one of- file_id
- filename
- filetype
- filesize
- url
- urltype
- md5
- all
-m MODALITY
is the modality in which you are searching within.-i IDs
the ID you are searching for.yaml
corresponds to theseqspec
file.--fullpath
expands localurl
values to absolute paths relative to the spec file.
Examples¶
# List paired read files
$ seqspec file -m rna spec.yaml
rna_R1_SRR18677638.fastq.gz rna_R2_SRR18677638.fastq.gz
# List interleaved read files
$ seqspec file -m rna -f interleaved spec.yaml
rna_R1_SRR18677638.fastq.gz
rna_R2_SRR18677638.fastq.gz
# List urls of all read files
$ seqspec file -m rna -f list -k url spec.yaml
rna_R1 rna_R1_SRR18677638.fastq.gz fastqs/rna_R1_SRR18677638.fastq.gz
rna_R2 rna_R2_SRR18677638.fastq.gz fastqs/rna_R2_SRR18677638.fastq.gz
# List all files in regions
$ seqspec file -m rna -f list -s region -k all spec.yaml
rna_cell_bc RNA-737K-arc-v1.txt RNA-737K-arc-v1.txt txt 2142553 https://github.com/pachterlab/qcbc/raw/main/tests/10xMOME/RNA-737K-arc-v1.txt.gz https a88cd21e801ae6f9a7d9a48b67ccf693
# List files for barcode regions in json
$ seqspec file -m rna -f json -s region-type -k all -i barcode spec.yaml
[
{
"file_id": "RNA-737K-arc-v1.txt",
"filename": "RNA-737K-arc-v1.txt",
"filetype": "txt",
"filesize": 2142553,
"url": "https://github.com/pachterlab/qcbc/raw/main/tests/10xMOME/RNA-737K-arc-v1.txt.gz",
"urltype": "https",
"md5": "a88cd21e801ae6f9a7d9a48b67ccf693"
}
]
Note: seqspec file -s read
gets the files for the read, not the files contained in the regions mapped to the read.
seqspec format
: Autoformat seqspec file¶
Automatically fill in missing fields in the spec.
seqspec format [-h] [-o OUT] yaml
from seqspec.seqspec_format import run_format
run_format(spec_fn: str, o: str)
-o OUT
the path to create the formattedseqspec
file.yaml
corresponds to theseqspec
file.
Examples¶
# format the spec and print the spec to stdout
$ seqspec format spec.yaml
# note you can also overwrite the spec you are formatting
$ seqspec format -o spec.yaml spec.yaml
seqspec index
: Identify position of elements in seqspec file¶
Identify the position of elements in a spec for use in downstream tools. Returns the 0-indexed position of elements contained in a given region in the 5’->3’ direction.
seqspec index [-h] [-o OUT] [-t TOOL] [-s SELECTOR] [--rev] [--subregion-type SUBREGIONTYPE] [--no-overlap] -m MODALITY [-i IDs] yaml
from seqspec.seqspec_index import run_index
run_index(spec_fn: str, modality: str, ids: List[str], idtype: str, fmt: str, rev: str, subregion_type: str, o)
- optionally,
-o OUT
can be used to write the output to a file. - optionally,
--rev
can be set to return the 3’->5’ index. - optionally,
-t TOOL
returns the indices in the format specified by the tool. One of:chromap
: emit barcode and genomic ranges in chromap--read-format
syntaxkb
:kallisto
/kb count
-x TECHNOLOGY
(format) requires a barcode, UMI, and sequence. The followingregion_type
are used during indexing:barcode
for the barcodeumi
for the umicdna
,gdna
,protein
, ortag
for the sequence
kb-single
: same askb
but forces a single feature segmentseqkit
:seqkit subseq
-r, --region string
(format)simpleaf
:simpleaf quant
-c, --chemistry
(format) requires a barcode, UMI, and sequence. The followingregion_type
are used during indexing:barcode
for the barcodeumi
for the umicdna
for the sequence
starsolo
:--soloCBstart
,--soloCBlen
,--soloUMIstart
,--soloUMIlen
(format) requires a barcode, UMI, and sequence. The followingregion_type
are used during indexing:barcode
for the barcodeumi
for the umicdna
for the sequence
splitcode
: splitcode@extract
lines and tag groupstab
: tab delimited file (region<\t>element<\t>start<t>end
)zumis
: yaml (format) requires a barcode, UMI, and sequence. The followingregion_type
are used during indexing:barcode
for the barcodeumi
for the umicdna
for the sequence
- optionally,
-s Selector
is the type of the ID you are searching for (default: read). Can be one of- read
- region
- file
-m MODALITY
is the modality that the-r REGION
region resides in.-i IDs
is the ID of the object you are indexing.yaml
corresponds to theseqspec
file.--subregion-type
filters to a specific region_type in some formats (e.g., seqkit)--no-overlap
removes overlapping regions across coordinates (stable, by first occurrence)
Examples¶
# get the indices of the elements contained within the FASTQs specified in the spec in tab format
$ seqspec index -m atac -s file -i atac_R1_SRR18677642.fastq.gz,atac_R2_SRR18677642.fastq.gz,atac_R3_SRR18677642.fastq.gz spec.yaml
atac_R1 gdna gdna 0 53
atac_R2 atac linker linker 0 8
atac_R2 Cell Barcode barcode 8 24
atac_R3 gdna gdna 0 53
# do the same but in the kb format
$ seqspec index -m atac -t kb -s file -i atac_R1_SRR18677642.fastq.gz,atac_R2_SRR18677642.fastq.gz,atac_R3_SRR18677642.fastq.gz spec.yaml
1,8,24:-1,-1,-1:0,0,53,2,0,53
# If the files are specified in the spec then -i can be omitted
$ seqspec index -m atac -t kb -s file spec.yaml
1,8,24:-1,-1,-1:0,0,53,2,0,53
seqspec info
: get info about seqspec file¶
seqspec info [-h] [-k KEY] [-f FORMAT] [-o OUT] yaml
from seqspec.seqspec_info import run_info
run_info(spec_fn: str, f: str, k=None, o=None)
- optionally,
-o OUT
path to write the info. - optionally,
-k KEY
the object to display (default: meta). Can be one of- modalities
- meta
- sequence_spec
- library_spec
- optionally,
-f FORMAT
the output format (default: tab). Can be one of- tab
- json
yaml
corresponds to theseqspec
file.
Examples¶
# Get meta information in json format
$ seqspec info -f json spec.yaml
{
"seqspec_version": "0.3.0",
"assay_id": "DOGMAseq-DIG",
"name": "DOGMAseq-DIG/Illumina",
"doi": "https://doi.org/10.1186/s13059-022-02698-8",
"date": "23 June 2022",
"description": "DOGMAseq with digitonin (DIG) is a single-cell multi-omics assay that simultaneously measures protein, RNA, and chromatin accessibility in single cells. The assay is based on the DOGMAseq technology, which uses a DNA-barcoded antibody library to capture proteins of interest, followed by a single-cell RNA-seq protocol and a single-cell ATAC-seq protocol. The DOGMAseq-LLL assay is designed to be compatible with the 10x Genomics Chromium platform.",
"lib_struct": "",
...
# long output omitted
# Get the list of modalities
$ seqspec info -k modalities spec.yaml
protein tag rna atac
# Get library spec in json format
$ seqspec info -f json -k library_spec spec.yaml
{
"protein": [
{
"region_id": "ghost_protein_truseq_read1",
"region_type": "named",
"name": "Truseq Read 1",
"sequence_type": "fixed",
"onlist": null,
"sequence": "",
"min_len": 0,
"max_len": 0,
"regions": []
},
...
# long output omitted
# Get sequence spec in json format
$ seqspec info -f json -k sequence_spec spec.yaml
[
{
"read_id": "protein_R1",
"name": "protein Read 1",
"modality": "protein",
"primer_id": "protein_truseq_read1",
"min_len": 28,
"max_len": 28,
"strand": "pos",
"files": [
...
# long output omitted
seqspec init
: Generate a new empty seqspec draft¶
Create a minimal, valid draft containing only meta Regions (one per modality). This is intended as a starting point to then insert regions and reads.
seqspec init [-h] -n NAME -m MODALITIES [--doi DOI] [--description DESC] [--date YYYY-MM-DD] [-o OUT]
-m MODALITIES
comma-separated list of modalities (e.g.,rna,atac
).-n NAME
assay name.--doi
,--description
,--date
optional metadata.-o OUT
optional output path (default: stdout).
Example:
seqspec init -n myassay -m rna,atac -o spec.yaml
seqspec methods
: Convert seqspec file into methods section¶
Generate a methods section from a seqspec file.
seqspec methods [-h] -m MODALITY [-o OUT] yaml
from seqspec.seqspec_methods import run_methods
run_methods(spec_fn: str, m: str, o: str)
- optionally,
-o OUT
path to write the methods section. -m MODALITY
is the modality to write the methods for.yaml
corresponds to theseqspec
file.
Examples¶
# print methods for rna modality
$ seqspec methods -m rna spec.yaml
Methods
The rna portion of the DOGMAseq-DIG/Illumina assay was generated on 23 June 2022.
Libary structure
The library was generated using the CG000338 Chromium Next GEM Multiome ATAC + Gene Expression Rev. D protocol (10x Genomics) library protocol and Illumina Truseq Single Index library kit. The library contains the following elements:
1. Truseq Read 1: 33-33bp fixed sequence (ACACTCTTTCCCTACACGACGCTCTTCCGATCT).
2. Cell Barcode: 16-16bp onlist sequence (NNNNNNNNNNNNNNNN), onlist file: RNA-737K-arc-v1.txt.
3. umi: 12-12bp random sequence (XXXXXXXXXXXX).
4. cdna: 102-102bp random sequence (XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX).
5. Truseq Read 2: 34-34bp fixed sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC).
Sequence structure
The library was sequenced on a Illumina NovaSeq 6000 (EFO:0008637) using the NovaSeq 6000 S2 Reagent Kit v1.5 (100 cycles) sequencing kit. The library was sequenced using the following configuration:
- rna Read 1: 28 cycles on the positive strand using the rna_truseq_read1 primer. The following files contain the sequences in Read 1:
- File 1: rna_R1_SRR18677638.fastq.gz
- rna Read 2: 102 cycles on the negative strand using the rna_truseq_read2 primer. The following files contain the sequences in Read 2:
- File 1: rna_R2_SRR18677638.fastq.gz
seqspec modify
: Modify attributes of various elements (JSON-based)¶
Modify objects by passing a JSON array of partial objects via --keys
. Only provided fields are applied.
seqspec modify [-h] -m MODALITY -s SELECTOR -k JSON [-o OUT] yaml
Selectors: read
, region
, file
, seqkit
, seqprotocol
, libkit
, libprotocol
, assay
.
Examples:
# Update a read name
seqspec modify -m rna -s read -k '[{"read_id":"rna_R1","name":"renamed_rna_R1"}]' spec.yaml
# Update a region name
seqspec modify -m rna -s region -k '[{"region_id":"rna_cell_bc","name":"Cell Barcode"}]' spec.yaml
# Update a file url
seqspec modify -m rna -s file -k '[{"file_id":"R1.fastq.gz","url":"./fastq/R1.fastq.gz"}]' spec.yaml
Examples¶
# modify the read id
$ seqspec modify -m atac -o mod_spec.yaml -i atac_R1 --read-id renamed_atac_R1 spec.yaml
# modify the region id
$ seqspec modify -m atac -o mod_spec.yaml -s region -i atac_cell_bc --region-id renamed_atac_cell_bc spec.yaml
# modify the files for R1 fastq
$ seqspec modify -m atac -o mod_spec.yaml -i atac_R1 --files "R1_1.fastq.gz,fastq,0,./fastq/R1_1.fastq.gz,local,null:R1_2.fastq.gz,fastq,0,./fastq/R1_2.fastq.gz,local,null" spec.yaml
seqspec onlist
: Get onlist file(s) for elements in seqspec file¶
seqspec onlist [-h] [-o OUT] [-s SELECTOR] [-f {product,multi}] -m MODALITY [-i ID] yaml
from seqspec.seqspec_onlist import run_onlist
run_onlist(spec_fn, modality, ids, idtype, fmt, o)
- optionally,
-o OUT
when set with-f
, writes the joined onlist to this file; when set without-f
, downloads remote onlists locally and prints paths. -m MODALITY
is the modality in which you are searching for the region.-i ID
is theid
of the object to search for the onlist.-s SELECTOR
is the type of theid
of the object (default: read). Can be one of:- read
- region
- region-type
-f
selects how to combine multiple onlists:product
(cartesian product)multi
(row-aligned, zip with padding)
yaml
corresponds to theseqspec
file.
Note: If, for example, there are multiple regions with the specified region_type
in the modality (e.g. multiple barcodes), then seqspec onlist
will return a path to an onlist that it generates where the entries in that onlist are the cartesian product of the onlists for all of the regions found.
Examples¶
# Get onlist for the element in the rna_R1 read
$ seqspec onlist -m rna -s read -i rna_R1 spec.yaml
/path/to/spec/folder/RNA-737K-arc-v1.txt
# Get onlist for barcode region type
$ seqspec onlist -m rna -s region-type -i barcode spec.yaml
/path/to/spec/folder/RNA-737K-arc-v1.txt
seqspec print
: Display the sequence and/or library structure from seqspec file¶
Print sequence and/or library structure as ascii, png, or html.
seqspec print [-h] [-o OUT] [-f FORMAT] yaml
from seqspec.seqspec_print import run_seqspec_print
run_seqspec_print(spec_fn, fmt, o)
- optionally,
-o OUT
to set the path of printed file. - optionally,
-f FORMAT
is the format of the printed file. Can be one of:library-ascii
: prints an ascii tree of the library_specseqspec-html
: prints an html of both the library_spec and sequence_spec (TODO this is incomplete)seqspec-png
: prints a png summary of modality structuresseqspec-ascii
: prints an ascii representation of both the library_spec and sequence_spec
yaml
corresponds to theseqspec
file.
Examples¶
# Print the library structure as ascii
$ seqspec print spec.yaml
┌─'ghost_protein_truseq_read1:0'
├─'protein_truseq_read1:33'
├─'protein_cell_bc:16'
┌─protein─┤
│ ├─'protein_umi:12'
│ ├─'protein_seq:15'
│ └─'protein_truseq_read2:34'
│ ┌─'tag_truseq_read1:33'
│ ├─'tag_cell_bc:16'
├─tag─────┼─'tag_umi:12'
│ ├─'tag_seq:15'
─┤ └─'tag_truseq_read2:34'
│ ┌─'rna_truseq_read1:33'
│ ├─'rna_cell_bc:16'
├─rna─────┼─'rna_umi:12'
│ ├─'cdna:102'
│ └─'rna_truseq_read2:34'
│ ┌─'atac_truseq_read1:33'
│ ├─'gDNA:100'
└─atac────┼─'atac_truseq_read2:34'
├─'spacer:8'
└─'atac_cell_bc:16'
# Print the sequence and library structure as ascii
$ seqspec print -f seqspec-ascii spec.yaml
protein
---
|--------------------------->(1) protein_R1
ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG
<--------------|(2) protein_R2
tag
---
|--------------------------->(1) tag_R1
ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG
<--------------|(2) tag_R2
rna
---
|--------------------------->(1) rna_R1
ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG
<-----------------------------------------------------------------------------------------------------|(2) rna_R2
atac
---
|---------------------------------------------------->(1) atac_R1
|----------------------->(2) atac_R2
ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGACGCGNNNNNNNNNNNNNNNN
TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGGTCTGCGCNNNNNNNNNNNNNNNN
<----------------------------------------------------|(3) atac_R3
# Print the sequence and library structure as html
$ seqspec print -f seqspec-html spec.yaml
<!DOCTYPE html>
<html>
<head>
<meta name="viewport" content="width=device-width, initial-scale=1" />
<style>
highlight {
color: green;
}
...
# long output omitted
# Print the library structure as a png
$ seqspec print -o spec.png -f seqspec-png spec.yaml
seqspec split
: Split seqspec file by modality¶
seqspec split [-h] -o OUT yaml
from seqspec.seqspec_split import run_split
run_split(spec_fn, o)
- optionally,
-o OUT
name prepended to split specs. yaml
corresponds to theseqspec
file.
Examples¶
# split spec into modalities
$ seqspec split -o split spec.yaml
$ ls -1
spec.yaml
split.atac.yaml
split.protein.yaml
split.rna.yaml
split.tag.yaml
seqspec version
: Get seqspec tool version and seqspec file version¶
seqspec version [-h] [-o OUT] yaml
from seqspec.seqspec_version import run_version
run_version(spec_fn, o)
- optionally,
-o OUT
path to file to write output. yaml
corresponds to theseqspec
file.
Examples¶
# Get versions of tool and file
$ seqspec version spec.yaml
seqspec version: 0.3.0
seqspec file version: 0.3.0
(HIDDEN) seqspec upgrade
: Upgrade seqspec file from older versions to the current version¶
This is a hidden subcommand that upgrades an old version of the spec to the current one. It is not intended to be used in a production environment.
seqspec upgrade [-h] [-o OUT] yaml
from seqspec.seqspec_upgrade import run_upgrade
run_upgrade(spec_fn, o)
Examples¶
# upgrade spec
$ seqspec upgrade -o spec.yaml spec.yaml
- Xu, Z., Heidrich-O’Hare, E., Chen, W., & Duerr, R. H. (2022). Comprehensive benchmarking of CITE-seq versus DOGMA-seq single cell multimodal omics. Genome Biology, 23(1). 10.1186/s13059-022-02698-8